Table 1

The primers used in the Real Time-PCR.

Genes

GenBank accession number

Primers


MAT

NM_013283

F: 5'- ACTTTGTTCCCGGGAGCTGTC -3'

R: 5'- AACTGCATGCCAATTATTCTGCTG -3'

SAHH

NM_000687

F: 5'- CACCACAGGCTGTATTGACATCATC -3'

R: 5'- GTCCAATGTTACACACAATGGCATC -3'

MTR

NM_000254

F: 5'-TAAGATTTGCAAAGGTTGGGTCTGA-3'

R: 5'-CTGGACATACAGGTGGGAGTTGG-3'

MTHFR

NM_005957

F: 5'- TGTGTGAATTCTGCAACTAGCCAAG -3'

R: 5'- ATGAGCCACCACACCTGCTG -3'

CSE

NM_153742

F: 5'-CCTTTGGCTCTGGGAGCTGATA-3'

R: 5'-ATTAACAGACACCAGGCCCATTACA-3'

CBS

NM_000071

F: 5'-TGTGGGCACACCATCGAGA-3'

R: 5'-AGCGTCACCATTCCCAGGATTA-3'

β-actin

NM_001101

F: 5'- CGACAACGGCTCCGGCATGT-3'

R: 5'- TGGGCCTCGTCGCCCACATA-3'


MAT: methionine adenosyltransferase; SAHH: S-adenosylhomocysteine hydrolase; MTR: 5-methyltetrahydrofolate-homocysteine methyltransferase; MTHFR: 5, 10-methylenetetrahydrofolate reductase; CSE: cystathionine γ-lyase; CBS: cystathionine β-synthase; β-action: housekeeping gene

Huang et al. Nutrition Journal 2012 11:6   doi:10.1186/1475-2891-11-6

Open Data